Review



sgrna targeting exon 5  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Addgene inc sgrna targeting exon 5
    Sgrna Targeting Exon 5, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 99 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sgrna targeting exon 5/product/Addgene inc
    Average 94 stars, based on 99 article reviews
    sgrna targeting exon 5 - by Bioz Stars, 2026-06
    94/100 stars

    Images



    Similar Products

    94
    Addgene inc sgrna targeting exon 5
    Sgrna Targeting Exon 5, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sgrna targeting exon 5/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    sgrna targeting exon 5 - by Bioz Stars, 2026-06
    94/100 stars
      Buy from Supplier

    90
    Macrogen sgrna targeting exon 5 of the nlrp3 gene
    Sgrna Targeting Exon 5 Of The Nlrp3 Gene, supplied by Macrogen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sgrna targeting exon 5 of the nlrp3 gene/product/Macrogen
    Average 90 stars, based on 1 article reviews
    sgrna targeting exon 5 of the nlrp3 gene - by Bioz Stars, 2026-06
    90/100 stars
      Buy from Supplier

    90
    Synthego Inc synthetic multi-sgrna kit targeting exon 5 of the alpk1 gene
    Synthetic Multi Sgrna Kit Targeting Exon 5 Of The Alpk1 Gene, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/synthetic multi-sgrna kit targeting exon 5 of the alpk1 gene/product/Synthego Inc
    Average 90 stars, based on 1 article reviews
    synthetic multi-sgrna kit targeting exon 5 of the alpk1 gene - by Bioz Stars, 2026-06
    90/100 stars
      Buy from Supplier

    90
    VectorBuilder GmbH sgrna targeting the psmg2 sequence ttccggtacctacttacacc (exon 5)
    Sgrna Targeting The Psmg2 Sequence Ttccggtacctacttacacc (Exon 5), supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sgrna targeting the psmg2 sequence ttccggtacctacttacacc (exon 5)/product/VectorBuilder GmbH
    Average 90 stars, based on 1 article reviews
    sgrna targeting the psmg2 sequence ttccggtacctacttacacc (exon 5) - by Bioz Stars, 2026-06
    90/100 stars
      Buy from Supplier

    90
    Synthego Inc guide rnas (sgrna) targeting exons 5 and 7
    Guide Rnas (Sgrna) Targeting Exons 5 And 7, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/guide rnas (sgrna) targeting exons 5 and 7/product/Synthego Inc
    Average 90 stars, based on 1 article reviews
    guide rnas (sgrna) targeting exons 5 and 7 - by Bioz Stars, 2026-06
    90/100 stars
      Buy from Supplier

    90
    Synthego Inc chemically modified single guide rna (sgrna) that targets rat g6pd exon 5
    Chemically Modified Single Guide Rna (Sgrna) That Targets Rat G6pd Exon 5, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/chemically modified single guide rna (sgrna) that targets rat g6pd exon 5/product/Synthego Inc
    Average 90 stars, based on 1 article reviews
    chemically modified single guide rna (sgrna) that targets rat g6pd exon 5 - by Bioz Stars, 2026-06
    90/100 stars
      Buy from Supplier

    90
    Addgene inc doxycycline-inducible sgrna lentiviral vectors targeting p53 at exons 4 and 5
    Doxycycline Inducible Sgrna Lentiviral Vectors Targeting P53 At Exons 4 And 5, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/doxycycline-inducible sgrna lentiviral vectors targeting p53 at exons 4 and 5/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    doxycycline-inducible sgrna lentiviral vectors targeting p53 at exons 4 and 5 - by Bioz Stars, 2026-06
    90/100 stars
      Buy from Supplier

    90
    Synthego Inc sgrna targeting the second exon of kctd13 (chr16:29923312–29923331; sequence 5′-ugag gauugu ac caa agu ga-3′)
    Hypothetical schematic of the oFlowSeq method to identify cell types affected by <t>KCTD13</t> mutations in CRISPR-edited cerebral organoids. A Schematic of oFlowSeq method using CRISPR-Cas9 editing of the KCTD13 gene in iPSCs to differentiate mosaic cerebral organoids. These mosaic organoids, which comprised of different cell types with different KCTD13 genotypes, were dissociated into single cells for FACS into seven sorted pools of cells. B Hypothetical schematic of cell counts for a deleterious mutation in KCTD13 that enriches for Nestin+ cells while depleting TRA-1–60+ cells, with an OR > 1 representing an enrichment; OR < 1 representing a depletion; and OR = 1 representing no changes in cell proportions. C Hypothetical schematic of cell counts for a deleterious mutation in KCTD13 that enriches for Nestin+ cells while depleting NeuN+ cells
    Sgrna Targeting The Second Exon Of Kctd13 (Chr16:29923312–29923331; Sequence 5′ Ugag Gauugu Ac Caa Agu Ga 3′), supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sgrna targeting the second exon of kctd13 (chr16:29923312–29923331; sequence 5′-ugag gauugu ac caa agu ga-3′)/product/Synthego Inc
    Average 90 stars, based on 1 article reviews
    sgrna targeting the second exon of kctd13 (chr16:29923312–29923331; sequence 5′-ugag gauugu ac caa agu ga-3′) - by Bioz Stars, 2026-06
    90/100 stars
      Buy from Supplier

    Image Search Results


    Hypothetical schematic of the oFlowSeq method to identify cell types affected by KCTD13 mutations in CRISPR-edited cerebral organoids. A Schematic of oFlowSeq method using CRISPR-Cas9 editing of the KCTD13 gene in iPSCs to differentiate mosaic cerebral organoids. These mosaic organoids, which comprised of different cell types with different KCTD13 genotypes, were dissociated into single cells for FACS into seven sorted pools of cells. B Hypothetical schematic of cell counts for a deleterious mutation in KCTD13 that enriches for Nestin+ cells while depleting TRA-1–60+ cells, with an OR > 1 representing an enrichment; OR < 1 representing a depletion; and OR = 1 representing no changes in cell proportions. C Hypothetical schematic of cell counts for a deleterious mutation in KCTD13 that enriches for Nestin+ cells while depleting NeuN+ cells

    Journal: Human genetics

    Article Title: oFlowSeq: a quantitative approach to identify protein coding mutations affecting cell type enrichment using mosaic CRISPR-Cas9 edited cerebral organoids

    doi: 10.1007/s00439-023-02534-4

    Figure Lengend Snippet: Hypothetical schematic of the oFlowSeq method to identify cell types affected by KCTD13 mutations in CRISPR-edited cerebral organoids. A Schematic of oFlowSeq method using CRISPR-Cas9 editing of the KCTD13 gene in iPSCs to differentiate mosaic cerebral organoids. These mosaic organoids, which comprised of different cell types with different KCTD13 genotypes, were dissociated into single cells for FACS into seven sorted pools of cells. B Hypothetical schematic of cell counts for a deleterious mutation in KCTD13 that enriches for Nestin+ cells while depleting TRA-1–60+ cells, with an OR > 1 representing an enrichment; OR < 1 representing a depletion; and OR = 1 representing no changes in cell proportions. C Hypothetical schematic of cell counts for a deleterious mutation in KCTD13 that enriches for Nestin+ cells while depleting NeuN+ cells

    Article Snippet: We used an sgRNA targeting the second exon of KCTD13 (chr16:29923312–29923331; sequence 5′-UGAG GAUUGU AC CAA AGU GA-3′) and Cas9 2NLS nuclease from Synthego, and incubated 3 μl of 100 μM sgRNA with 2 μl of 20 μM Cas9 nuclease at room temperature for 10 min prior to nucleofection.

    Techniques: CRISPR, Mutagenesis

    Odds ratios to correlate mutations with cell type proportions. A Hypothetical expected distribution of ORs for benign mutations that do not affect cell type proportions (in blue). B Hypothetical expected distribution of ORs for benign mutations that do not affect cell type proportions (in blue), and deleterious mutations that increase cell type proportions (in pink). C Observed density distributions of short mutations (red), long mutations (blue), and all mutations (black) for NeuN, Nestin, and TRA-1–60 positively stained cells. D Observed heatmap representation of the scaled odds ratios for each of the 19 synthetic mutations in KCTD13 for TRA-1–60, Nestin, and NeuN positively stained cells

    Journal: Human genetics

    Article Title: oFlowSeq: a quantitative approach to identify protein coding mutations affecting cell type enrichment using mosaic CRISPR-Cas9 edited cerebral organoids

    doi: 10.1007/s00439-023-02534-4

    Figure Lengend Snippet: Odds ratios to correlate mutations with cell type proportions. A Hypothetical expected distribution of ORs for benign mutations that do not affect cell type proportions (in blue). B Hypothetical expected distribution of ORs for benign mutations that do not affect cell type proportions (in blue), and deleterious mutations that increase cell type proportions (in pink). C Observed density distributions of short mutations (red), long mutations (blue), and all mutations (black) for NeuN, Nestin, and TRA-1–60 positively stained cells. D Observed heatmap representation of the scaled odds ratios for each of the 19 synthetic mutations in KCTD13 for TRA-1–60, Nestin, and NeuN positively stained cells

    Article Snippet: We used an sgRNA targeting the second exon of KCTD13 (chr16:29923312–29923331; sequence 5′-UGAG GAUUGU AC CAA AGU GA-3′) and Cas9 2NLS nuclease from Synthego, and incubated 3 μl of 100 μM sgRNA with 2 μl of 20 μM Cas9 nuclease at room temperature for 10 min prior to nucleofection.

    Techniques: Staining